Reproducible Bioinformatics with Python by Ken Youens-Clark

Reproducible Bioinformatics with Python by Ken Youens-Clark

Author:Ken Youens-Clark [Ken Youens-Clark]
Language: eng
Format: epub
Publisher: O'Reilly Media, Inc.
Published: 2021-07-24T16:00:00+00:00


>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', 'P', 'R', 'T', 'E', 'I', 'N', 'S', 'T', 'R', 'I', 'N', 'G', '*']

The * codon indicates where the translation should end and should not be included in the output. Your algorithm should consider that the stop codon may occur before the end of the RNA string and should halt accordingly. This should be enough hints for you to create a solution that passes the tests. Be sure to run pytest and make test to ensure your program is logically and stylistically correct.



Download



Copyright Disclaimer:
This site does not store any files on its server. We only index and link to content provided by other sites. Please contact the content providers to delete copyright contents if any and email us, we'll remove relevant links or contents immediately.
Popular ebooks
Whisky: Malt Whiskies of Scotland (Collins Little Books) by dominic roskrow(55915)
What's Done in Darkness by Kayla Perrin(26529)
Shot Through the Heart: DI Grace Fisher 2 by Isabelle Grey(19009)
The Fifty Shades Trilogy & Grey by E L James(18965)
Shot Through the Heart by Mercy Celeste(18882)
Wolf & Parchment: New Theory Spice & Wolf, Vol. 10 by Isuna Hasekura and Jyuu Ayakura(16992)
Python GUI Applications using PyQt5 : The hands-on guide to build apps with Python by Verdugo Leire(16879)
Peren F. Statistics for Business and Economics...Essential Formulas 3ed 2025 by Unknown(16808)
Wolf & Parchment: New Theory Spice & Wolf, Vol. 03 by Isuna Hasekura and Jyuu Ayakura & Jyuu Ayakura(16705)
Wolf & Parchment: New Theory Spice & Wolf, Vol. 01 by Isuna Hasekura and Jyuu Ayakura & Jyuu Ayakura(16334)
The Subtle Art of Not Giving a F*ck by Mark Manson(14263)
The 3rd Cycle of the Betrayed Series Collection: Extremely Controversial Historical Thrillers (Betrayed Series Boxed set) by McCray Carolyn(14072)
Stepbrother Stories 2 - 21 Taboo Story Collection (Brother Sister Stepbrother Stepsister Taboo Pseudo Incest Family Virgin Creampie Pregnant Forced Pregnancy Breeding) by Roxi Harding(13433)
Scorched Earth by Nick Kyme(12716)
Drei Generationen auf dem Jakobsweg by Stein Pia(10925)
Suna by Ziefle Pia(10847)
Scythe by Neal Shusterman(10273)
International Relations from the Global South; Worlds of Difference; First Edition by Arlene B. Tickner & Karen Smith(9479)
Successful Proposal Strategies for Small Businesses: Using Knowledge Management ot Win Govenment, Private Sector, and International Contracts 3rd Edition by Robert Frey(9317)
This is Going to Hurt by Adam Kay(9107)